Keyword Analysis & Research: addgene plko.1

addgene.org

https://www.addgene.org/protocols/plko/

WEBpLKO.1 is a replication-incompetent lentiviral vector chosen by the TRC for expression of shRNAs. pLKO.1 can be introduced into cells via direct transfection, or can be converted into lentiviral particles for subsequent infection of a target cell line.

DA: 88 PA: 44 MOZ Rank: 23

addgene.org

https://www.addgene.org/8453/

WEBPurpose. (Empty Backbone) 3rd gen lentiviral backbone for cloning and expression of new shRNA sequences. Uses puromycin for selection. Depositing Lab. Bob Weinberg. …

DA: 22 PA: 67 MOZ Rank: 92

addgene.org

https://www.addgene.org/8453/sequences/

WEBpLKO.1 puro. Sequences (5) Based on next-generation sequencing (NGS) results where indicated (Addgene NGS Result), or assembled from reference sequences and/or Sanger results (Addgene Assembled Sequence). Addgene has sequenced portions of this plasmid for verification. The results are shown below.

DA: 25 PA: 49 MOZ Rank: 56

snapgene.com

https://www.snapgene.com/plasmids/viral_expression_and_packaging_vectors/pLKO.1

WEBpLKO.1 Sequence and Map. Stuffer-containing lentiviral vector for expression of shRNA. This plasmid is the official TRC cloning vector. Sequence Author: The RNAi Consortium. Open in SnapGene. Try SnapGene for Free. Download Plasmid. | Download SnapGene Viewer. Explore Over 2.7k Plasmids: Viral Expression & Packaging Vectors | More Plasmid Sets. addgene

addgene

DA: 90 PA: 71 MOZ Rank: 64

snapgene.com

https://www.snapgene.com/plasmids/viral_expression_and_packaging_vectors/pLKO.1_puro

WEBpLKO.1 puro. Empty lentiviral vector for expression of shRNA. See also pLKO.1. Efficient cleavage requires at least two copies of the BfuAI recognition sequence. Sticky ends from different BfuAI sites may not be compatible. BfuAI is typically used at 50°C, but is 50% active at 37°C. Efficient cleavage requires at least two copies of the BspMI ...

DA: 39 PA: 84 MOZ Rank: 40

addgene.org

https://blog.addgene.org/sharing-your-lab-protocols-using-apps-to-save-you-time-and-track-your-experiments

WEBBy Caroline LaManna. Recently I learned that Addgene’s pLKO.1 cloning protocol is viewed around 3,000 times each month. I looked this up after trying out the new protocols.io beta platform for sharing, annotating, and storing life science protocols.

DA: 81 PA: 93 MOZ Rank: 69

nih.gov

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7333533/

WEBMar 6, 2020 · Abstract. A widely used third-generation lentiviral packaging system produces virus with enhanced biosafety by eliminating HIV accessory genes and separating packaging elements into three different plasmids. However, for certain vectors such as pLKO.1, third-generation safety features reduce lentiviral titers due to the lack of the accessory ...

DA: 31 PA: 80 MOZ Rank: 2

broadinstitute.org

https://portals.broadinstitute.org/gpp/public/vector/details?vector=pLKO.1

WEBpLKO.1 Alias: pLKO_001, pLKO_TRC001 Pol II Cassette 1: PGK-PuroR Pol II Cassette 2: n/a Pol III Promoter: constitutive hU6 Pol III Insert: 1.9 KB Stuffer ... Link to this entity's page in the Addgene catalog, if available; 1: TRCN0000072200: AGTACAACTACAACAGCCACA GFP: GFP CONTROL CDS n/a 2: TRCN0000207152: AGTTCGTGACCGCCGCCGGGA GFP:

DA: 42 PA: 89 MOZ Rank: 52

sigmaaldrich.com

https://www.sigmaaldrich.com/US/en/technical-documents/technical-article/genomics/gene-expression-and-silencing/plko-1-vector-shrna

WEBThe pLKO.1 vector is a lentiviral (HIV)-based plasmid. The vector is regarded as a bio-safety level 2 material and safe to use due to its modified features (deletion of a number of accessory genes implicated in the virulence of HIV, minimal genome of the viral particles, non-replicating and self-inactivation features), making it incapable of ... addgene

addgene

DA: 75 PA: 47 MOZ Rank: 74

researchgate.net

https://www.researchgate.net/publication/364081622_Cloning_shRNA_Oligos_into_pLKO1_v2

WEBDec 31, 2019 · Abstract. This is the protocol accompanying the "pLKO.1 – TRC Cloning Vector". For information about the PLKO.1-TRC cloning vector and tips on designing shRNA oligos for pLKO.1 see...

DA: 96 PA: 33 MOZ Rank: 80